Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST372941
Clone ID OST372941
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST372941
Sequence
GACTGAGGTCACGCGTCCCCGTCTCTCACATCCAGCACCGCCAACGATCGAATCCTTAAGTACAACCTGATTAACGACAC
CCTCAACATTGCGGTCCCCAACGGCGAGATTCCCGACTGCAAGTGGAACAAGTCTCCCCCCAAGGAAGTACTTGGCAACT
ATGAGATCCTGTATGACGAGGAGCTGGCCCAGGGTGACGGGGCTGAACGAGAGCTTAGAAACCGCCCAGGCCAGCCAGTG
GGGCCCAGAGCAGGCCGCTCGAGAGACTCAGGAAGAAGTGTCCTCACAACCTGGAAGTGACCAGCAGCGAGAAGAAGGAC
CCCAGCTTGGACCTTCCCACAGTCGCTCCACCCAGTCCCTGCTAAACACCCGTTTTGGAATTTCAGTTTTCCAGAGTGCT
TTCCTGAGCAGGCCTTGTAAATAAAGACTCAATGCAAGGTG
Sequence Type mRNA
Unitrap ID UNI20104

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 83314473..83320064 271
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022442 (Ttll1) NM_178869 tubulin tyrosine ligase-like 1 Gene [Source:MGI (curated);Acc:Ttll1-001]

 
Come back to gene ENSMUSG00000022442


For any suggestions or comments, please send an email to unitrap@crg.es