Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AV0441
Clone ID AV0441
Vector pGT0lxr
Project sanger

Sequence tag AV0441
Sequence
CAGTTCATAAATGCACTGGTCACCTCTCCATATGATCTTGATTTTCGAATTCATTNGAGGAATGAATTCCTTCGTTGTGG
ATTAAAAGCAATGCTCCCTACTCTTAAAGAGATAGAGAATGAAGGGCTTGATATTCAGTTGAGAGTGTTTGAAGAGAACA
AAGAAGATGACCTAAGTGAATTATCCCACCGTCTCAATGACATTCGAGCTGAAATGGATGATATTAATGAAGTCTACCAT
CTGCTGTATAATATGCTGAAGGACACTGCTGCGGAACCTTACTTATTATCCATTCTCCAACACTTTCTGCTCATCAGAAA
TGATTACTACATCAGGCCACAGTATTATAAAATCATTGAGGAGTGTGTTTCACAGATAGTGCTACACTGCAGTTGCATGG
ACCCAGACTTCAAGTACCGGCAGCGCATAGACTTTGATTTCACTCATCTCCTAGATGCTTGTGTAAATAAGGCAAAAGTT
GAAGAAAATGAGCAAAAAGCAATGGAATTTTCAAAGAAG
Sequence Type mRNA
Unitrap ID UNI3908

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 126487221..126497520 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034480 (Diap2) NM_017398 diaphanous homolog 2 (Drosophila) Gene [Source:MGI (curated);Acc:Diap2-001]

 
Come back to gene ENSMUSG00000034480


For any suggestions or comments, please send an email to unitrap@crg.es