Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST372528
Clone ID OST372528
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST372528
Sequence
AAAGAAGCAGCAACAGTGGAAGAGCTGAACCCCAAAGGCATCCCTGAGTTCTGGTTCACCATCTTCAGAAATGTGGACAT
GCTTAGTGAGCTGGTGCAGGAATATGATGAACCGATCTTGAAACATCTGCAGGATATTAAAGTGAAGTTTTCAGACCCTG
GACAACCTATGTCTTTTG
Sequence Type mRNA
Unitrap ID UNI20114

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150718214..150720289 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059119 (Nap1l4) NM_008672 nucleosome assembly protein 1-like 4 Gene [Source:MGI Symbol;Acc:MGI:1316687]

 
Come back to gene ENSMUSG00000059119


For any suggestions or comments, please send an email to unitrap@crg.es