Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST372465
Clone ID OST372465
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST372465
Sequence
GACTGAGGACACTGAGAAGAGAACCCCTTTGCATGCTGCTGCCTATCTTGGTGACGCAGAAATCATTGAGCTGCTTATTT
TATCTGGTATGGCAACTCCTGAGCTGAGTTCATGGTGTTCAGTTTGATGTATGAGTGTTCCTATGGAATGCATAGCCTAT
GTCTTAGTATTGGTTTCATAAGTTAACCAATTATAATAGCAAACTTTGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI4402

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 32577317..32577520 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014496 (Ankrd28) NM_001024604 ankyrin repeat domain 28 Gene [Source:MGI Symbol;Acc:MGI:2145661]

 
Come back to gene ENSMUSG00000014496


For any suggestions or comments, please send an email to unitrap@crg.es