Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST372448
Clone ID OST372448
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST372448
Sequence
TGAGATCTTATTTTGTACCTTAAATACGCCTAAAATTGACATGGGAAAGCTCCTGGGTGGGCAGCTGGGCCTTGAGGATT
TCATATTTGCCCACGTGAAAGGCACAAAAAAGGAAGTGAATGTTTATAAATCAGAGGATTCGCTTGGACTCACCATCACG
GATAACGGCGTGGGCTATGCTTTTATCAAGAGAATTAAAGATGGCAGCACCATTGACTCAGTTAAAACGATCTGTGTGGG
GGATCATATCGAATGTATAAACGGAGAAAATATTGTTGGGTGGCGTCACTTTGAAGTCGCTAAGAAGTTAAAGGAATTGA
AAAAGGAGGAGCTCTTTACTTTGCAGNCTAATAGAACCCAAGAAGGCTTTTGAAATAGGACCAAGGCTCGAAAGCCNGAN
AGACATCAACAGAAAAANTTGNTACNTCAAGAGGGACCCTCCGTCTGAGATTGAAAGGCCCCGCTACCCNTCNNAGCGCT
GCCCTCTTGAA
Sequence Type mRNA
Unitrap ID UNI20118

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 151770918..151800724 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039131 (Gipc2) NM_016867 GIPC PDZ domain containing family, member 2 Gene [Source:MGI (curated);Acc:Gipc2-001]

 
Come back to gene ENSMUSG00000039131


For any suggestions or comments, please send an email to unitrap@crg.es