Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST372413
Clone ID OST372413
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST372413
Sequence
CCTCCAAGCCTGGAATTGTGCATAGCCTGGGTCTTGTATCTTTGTATAACGGATGTTATTTGTACGAAGGGCAGNTCGTA
AACAGCACTTGTTCTTTTAATAAAAGAATGTT
Sequence Type mRNA
Unitrap ID UNI2740

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97546641..97546752 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038437 (Mllt6) NM_139311 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 Gene [Source:MGI (curated);Acc:Mllt6-001]

 
Come back to gene ENSMUSG00000038437


For any suggestions or comments, please send an email to unitrap@crg.es