Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST372201
Clone ID OST372201
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST372201
Sequence
GACTGAGATGGCTGATTCCGATCCTGGGGTAAAGAAGCTATGATAACATGCTGAAAATGCTGTCTGACCTGAACAAGGAC
CTGGAAAAGCTATTGGAAGAGATGGAAAAAATCTCAGTGCAGGCAACCTGGATGGCCTATGATATGGTGGTCATGCCGTA
CGAACCCCACACTATCAGAGTCCATGCGCCGGCTAGAAGACGCCTTCCTCAACTGCAAAGAGGAGATGGAGAAGAACTGG
CAAGAGCTGCTCACTGAGACCAAGCGCAAGCAGTGAGCTACCATCTGTCAGCAGCCTGTGGGCCGAAGCCAGGGACATGG
GTCCAGAAGCCCAGACGTGTAGCCATGTGCATGGTACTTGTTTCTCAATAAACTTATTTTCACGGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI20125

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 89220596..89227867 268
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078938 (AC113976.13) Testis-specific expressed protein 2 [Source:UniProtKB/TrEMBL;Acc:B5KM66]

 
Come back to gene ENSMUSG00000078938


For any suggestions or comments, please send an email to unitrap@crg.es