Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST371959
Clone ID OST371959
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST371959
Sequence
TGAGGTACTGCCCTTAGTTTNGGCCAGTGAAAACCTGCCGGGCTTAGACCGTCATGAGCGAGGCCAGTAGAGATGATTAT
AAAATCCAGNCTTTTGATGCAGAGACGCAGCAGCTGCTGAAGACCGCGCTCAAAGATCCAAGTGCTGTGGACTTAGAGAG
AGTAGCCAACGTGATTGTGGACCATTCTCTGCAGGACTGTGTATTCAGCAAGGAAGCAGGACGCATGTGCTACGCCATCA
TTCAGGCAGAGAGTAAGCAAGCGGGCCAGAGCGTCTTCCGCCGTGGGCTCCTCAACCGGCTGCAGAAGGAGTATGATGCG
CGGNAGCAGCTCCNAGCATGCTCCCTGCAGGGCTGGGCTCTGCTATGTNACCTTTATNTGCAACANCTTTGACTACCTGC
GGGTGAACAACATGCCCATGATGGCCCCTGNCTAACCNTGTTCTATGACCTGTCTCTTCCA
Sequence Type mRNA
Unitrap ID UNI20131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 115470412..115473350 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020743 (Mif4gd) NM_027162 MIF4G domain containing Gene [Source:MGI (curated);Acc:Mif4gd-001]

 
Come back to gene ENSMUSG00000020743


For any suggestions or comments, please send an email to unitrap@crg.es