Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AT0295
Clone ID AT0295
Vector pGT0lxr
Project sanger

Sequence tag AT0295
Sequence
AAGAGGACGACGACGACGACGAGAACGGGGTGGGCGATGCGGAGCTGCAGGAGCAGCTCCGGCGCTGCGAGGCCACCATC
GAGCAGCTCCGCGCCGAGAATCAAGAACTTAAAAGAAAGTTGAACATTCTGACAAGACCCAGTGGCATACTGGTGAGCAA
TACTAAGATAGATGGACCGTTACTACAAATTCTATTTATGAACAATGCTATCTCAAAGCAATACCACCAAGAAATAGAGG
AGTTTGTATCAAACTTAGTAAAACGATTTGAGGAACAGCAAAAAAATGACGTGGAAAAGACTTCCTTCAGCCTTTTACCC
CAGCCGTCCAGTGTTATGTTGGAAGAGGACCATAAAGTGGAAGAATCATGTGCCGTTAAAAACAACAAGGAAGCTTTTAG
TGTTGTAGGAAGTGTCCTGTATTTTACTAATTTTTGCCTTGATAAATTGGGGCAACCGCTACTAAATGAAAACCCTCAGC
TTACGGAAGGATGGGAAATACCCAAGTACCAGCAAGTCTTCAGCCACATTGTTCCTCTAGAAGGGCAAGAGATGCAAGTG
AAGGCAAAAAG
Sequence Type mRNA
Unitrap ID UNI3920

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 124159204..124170830 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029427 (Zcchc8) NP_081770 zinc finger, CCHC domain containing 8 Gene [Source:MGI Symbol;Acc:MGI:1917900]

 
Come back to gene ENSMUSG00000029427


For any suggestions or comments, please send an email to unitrap@crg.es