Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST371480
Clone ID OST371480
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST371480
Sequence
GACTGAGAATGTTGGCTTCCGAGCGCTGAGCCTGATTGGCAAGAGAGCCATTTCTACTTCGGTGTGCCTTCGAGCACATG
GGAGTGTTGTGAAGAGTGAAGACTATGCTTTCCCCACTTACGCTGATCGGCGTGACTACCCCTTGCCTGATGTGGCCCAT
GTCACGATGCTGTCTGCCAGCCAGAAGGCGCTGAAGGAGAAGGAGAAGGCCGACTGGAGCAGCCTTTCCAGGGATGAGAA
AGTTCAGTTGTACCGCATCCAGTTTAACGAGAGCTTCGCCGAGATGAACAGGGGCACCAATGAATGGAAGACAGTTGTGG
GCATGGCCATGTTCTTCATTGGCTTCACTGCGCTCGTTCTGATTTGGGAGAAGAGCTATGTGTATGGCCCCATCCCTCAT
ACTTTCGATCGTGACTGGGTGGCCATGCAGACCAAGCGAATGCTGGACATGAAGGCCAACCCCATTCAGGGCTTCTCCGC
CAAGTGGGACTATGACAAGAATGAGTGGAAGAAGTGAGAGCCCGCTGCCTGCCGGCTCCCTGCCTCCCTTG
Sequence Type mRNA
Unitrap ID UNI11587

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123193207..123198039 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031818 (Cox4i1) NM_009941 cytochrome c oxidase subunit IV isoform 1 Gene [Source:MGI Symbol;Acc:MGI:88473]

 
Come back to gene ENSMUSG00000031818


For any suggestions or comments, please send an email to unitrap@crg.es