Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AT0173
Clone ID AT0173
Vector pGT0lxr
Project sanger

Sequence tag AT0173
Sequence
GGTGGCCGGGCGCGGAGGTGATTCTACAGTGAGGAGGAACGCGACGGCGAGGGTGGCAGTGGCAGCGTTCGTGTGCTCGG
GTCTGAATCGCTGAGGGAGGAGGCGGCGGCGGAGGAAGAGGTGGCAGCGGTGGCGGTGGTCGTAGCGGTGGCGGAGGAGG
CGGGTACGAATCAGCTGCGGGCAGAGACATGGCCAACATCGCGGTGCAGCGAATCAAGCGGGAGTTCAAGGAGGTGCTGA
AGAGCGAGGAGACGAGCAAAAATCAAATTAAAGTAGATCTTGTAGATGAGAATTTTACAGAATTAAGAGGAGAAATAGCA
GGACCTCCAGACACACCGTATGAAGGTGGAAGATATCAACTAGAGATAAAAATACCAGAAACATATCCATTTAACCCCCC
TAAG
Sequence Type mRNA
Unitrap ID UNI1390

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65928535..65962829 251
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029203 (Hip2) NM_016786 ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast) Gene [Source:MGI (curated);Acc:Hip2-003]

 
Come back to gene ENSMUSG00000029203


For any suggestions or comments, please send an email to unitrap@crg.es