Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST371083
Clone ID OST371083
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST371083
Sequence
GACTGAGCTCGAGATGCAGACGAGCGAGAGAAGTGGATCCATGCCTTAGAAGAAACTATTCTTCGCCATACTCTTCAGCT
TCAAGGATGNGNNGCNNGATGNANCCCCAGNGTCCAAGACTTTGATANGANANTTACCGAGGCTGACGCGGTACCTGCAG
ATCTTGATAGAACAATTAAAGCTTT
Sequence Type mRNA
Unitrap ID UNI20157

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108775102..108806427 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028559 (Osbpl9) NM_133885 oxysterol binding protein-like 9 Gene [Source:MGI (curated);Acc:Osbpl9-001]

 
Come back to gene ENSMUSG00000028559


For any suggestions or comments, please send an email to unitrap@crg.es