Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST370977
Clone ID OST370977
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST370977
Sequence
TGAGGGGACAAAGGCGTTCAGATGGCAGAAACAGTCTTTCAGATGGAGGCCCTGCAGATTCTGTGGAAGCTGCTAAAAAT
GCCAGTAATACAGAAAAACTCACAGACCAGGTGATGCAGAACCCACAAGTGCTGGCAGCTTTGCAGGAACGTCTTGACAA
CGTCTCTCACACTCCTTCTAGTTACATAGAAACTTTACCTAAAGCTGTCAAAAGAAGAATTAATGCCCTGAAGCANGTNC
AGGGGAGGNGTGCGCACATAGAAGCTAAGTTCTACGAGGAAGGAGNTNNCCNGGACAGGNAGAATGCCNCCNNGCANCTG
GNNTGNTATGACTCNACACTANNNTACTAAACNNGCNCTCAGCGCCTGNTNTNCAGACTNTCTNCNAGCCCCACGGANCC
ACGATGNACANAATCATTTTGACCAGCAGGTCTGCAGACCCTTCCCCCACTGCTCAAAGTCCTCCCGTGCTTGGTGNGNG
GGACCACCGGCTCCACCCT
Sequence Type mRNA
Unitrap ID UNI20161

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150721831..150727685 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059119 (Nap1l4) NM_008672 nucleosome assembly protein 1-like 4 Gene [Source:MGI Symbol;Acc:MGI:1316687]

 
Come back to gene ENSMUSG00000059119


For any suggestions or comments, please send an email to unitrap@crg.es