Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST370957
Clone ID OST370957
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST370957
Sequence
ACTGAGGACCCAGCCTCGATGCCCACTTGAAAGGCCGGAAGCACCGGGATTTGGTGCAACTCCGAGCTACCAGGAAGGCA
CAGGGACTCCGAAGTGTGTTTGTCAGTGGCTTCCCCAGGGATGTGGGTTCTGCTCAGCTCTCTGAGTACTTCCAGACATT
TGGCCCTGTGGCCAATATTGTCATGGACAAGGACAAGGTAGAGTGAATGGCTCTGGGATTAATGTGTTTGCTTNATATGC
AGAGAGAGAAACCTGCAGTCTGTTTTGGCTTGCCCTTGGTAGACAATTCAGAACATTAAGTAGCTCAG
Sequence Type mRNA
Unitrap ID UNI11442

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 9029875..9030178 302
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071645 (Tut1) NM_197993 terminal uridylyl transferase 1, U6 snRNA-specific Gene [Source:MGI Symbol;Acc:MGI:1917294]

 
Come back to gene ENSMUSG00000071645


For any suggestions or comments, please send an email to unitrap@crg.es