Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST370946
Clone ID OST370946
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST370946
Sequence
GACTGAGGGTCAGTTAAATGAAAGCATGGNCCATGGGGGAGTTGGACCATATGAACTTGGCATGGAACATTGTGAGAAAT
TTGAAATCTCAGAAACTAGTGTGAACAGAGGGCCAGAAAAAATCAGACCAGAATGTTTTGAGCTACTTCGGGTACTTGGT
AAAGGGGGCTATGGAAAGGTTTTTCAAGTACCGAAAAGTAACAGGAGCAAATACCTGGGAAGATATTTGCCATGAAGGTG
CTTAAAAAGGCNATGATAGTGAGGAATGCTAAGGACACGGCCCACACGAAAGCAGAGCGGAACATTCTGGAGGAAGTGAA
ACACCCTTTCATTGTGGACCTGATTTATGCCTTTCAGACCGGAGGGAAGCTCTACCTCATCCTCGAGTATCTCAGTGGTT
AGTACTGCTGCCTCCCACGCTCCTTTCCAGGGACATTGTGAGCACGGCTAAAAACTGGTGAATTCATCCAAGAAAGAAAT
TCACATATGAACAAATGGTTCTTTTTACAGACAAATATGAAAGAAACTTGGAAGGTTTTCCTATCTGGAAA
Sequence Type mRNA
Unitrap ID UNI6893

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86333240..86348964 298
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020516 (Rps6kb1) NM_028259 ribosomal protein S6 kinase, polypeptide 1 Gene [Source:MGI (curated);Acc:Rps6kb1-001]

 
Come back to gene ENSMUSG00000020516


For any suggestions or comments, please send an email to unitrap@crg.es