Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AS0671
Clone ID AS0671
Vector pGT0lxr
Project sanger

Sequence tag AS0671
Sequence
TTTGAGAGCTGTTTTATATTTTGGTTGTGAGCTCTTCTAGATGGTTTCACCAAGATAATGATGCTAAGCCGTGGCTTTGG
AAATTCTTTGGTTGCTTTTCTCGTCCCGAGCAGACATTGCCTCTTAGTTCCCAAACGAAAGAGTACATGGAGAACAAGAA
AGCTGCTGTGGAGTTAAAGGATATACCATCTCCCCTTCATGTTGGCTCTAAATTTTTCCCAGCAGTCCCACTTCCTGATA
TTCGTTCTCTTCAGCAACCTAAAGTACAGCTCTCAGCTATTCCCAAA
Sequence Type mRNA
Unitrap ID UNI3937

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14152656..14154022 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060657 (4921513D23Rik) NM_001081154 RIKEN cDNA 4921513D23 gene Gene [Source:MGI Symbol;Acc:MGI:2444505]

 
Come back to gene ENSMUSG00000060657


For any suggestions or comments, please send an email to unitrap@crg.es