Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST370338
Clone ID OST370338
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST370338
Sequence
CTCCTTTGGCATCTGTGNGGTGAAGGATGACACTAAAATCAGCATCGAACCTGATGGAGCTCTGCAATGTAGCATGCTCC
AGTGTGATGCCAGGAGGGGGCACCAACCTGGAGCTTGCCCTGCACATGCCTGCATGATGCCCAGGGCAGTGTTCAGGTTG
CCCTGGAGACTCTGTTACTCAGAGGACCCCAGAAGCCCCGGACTCACCCACTGGTTGACTATCGATACACAGGNTCAGAC
ATTTGGACCCCCATGGAGAAGAGGCTCTTCAAGAAGGCATTCTGTGCCCACAAGAAGGACTTTTACCTGATACACAAGAC
GATCCAAANTAAAAGTGTAGCACAGCGNAAGCGAGTACTACTACATC
Sequence Type mRNA
Unitrap ID UNI20168

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 16675159..16680535 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078796 (Zfp541) NM_001099277 zinc finger protein 541 Gene [Source:MGI Symbol;Acc:MGI:3647699]

 
Come back to gene ENSMUSG00000078796


For any suggestions or comments, please send an email to unitrap@crg.es