Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AS0652
Clone ID AS0652
Vector pGT0lxr
Project sanger

Sequence tag AS0652
Sequence
ATGGTGGTTGTGAGCTTTTGTAGATGGTGGTTGTGAGCTCTTCTAGATGGTGGTTGTGAGCTCTTCTAGATGGTTTTTTA
CCATTCCCTGTTCCTCCGATTCACCAGAATTCTAAGCTTGGTAAAAACATGGAGAAACATGGTGAAAAGCTGACCTTTTC
CTTCTTTCTTGGCTAGTGTGCTGGAGAAGAGAAACGAGTTGGTACACGCACAGTGTTTGTTGGCAATCATCCCATTTCTG
GAACAGAACCTTATATTGCGCAAAGATTTTGTGATAATAGAATAGTCTCATCTAAG
Sequence Type mRNA
Unitrap ID UNI3940

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 57574611..57574844 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062949 (Atp11c) NM_001037863 ATPase, class VI, type 11C Gene [Source:MGI Symbol;Acc:MGI:1859661]

 
Come back to gene ENSMUSG00000062949


For any suggestions or comments, please send an email to unitrap@crg.es