Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST370047
Clone ID OST370047
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST370047
Sequence
TGAGTCCAGCCAAGCGGGGCGCGGGGNCCATGGGTGCCTGGATATCCAGGACCCGGGTCCCGACGCCGGAGCCCGACCCC
CAGGAGGTCCTGGACCTGAGCCGTCTGCCCCCGGAGCTGCTCCTGCTGGTACTGAGCCACGTGCCCCCGCGCACGCTGCT
GATGCACTGCCGCCGAGTGTGCCGCGCCTGGCGCGCCCTGGTAGATGGCCAGGCCCTATGGTTGCTGCTGCTGGCCCGTG
ACCACAGCGCAGCGGGCCGCGCCCTGCTGACACTAGCCCGCCGCTGTCTGCCCCCTGCCCACGAAGACACGCCCTGCCCG
CTGGGCCAATTCTGCGCACTGAGACCGCTAGGACGCAACCTCATCAGCAACCCCTGTGGCCAAGAAGGCCTGCGCAAATG
GATGGTGCGGCACGGTGGGGATGGATGGGTGGTGGANAANAACAGGANACCTGNNCCTGGGGCCCCTTCACAGACCTGCT
T
Sequence Type mRNA
Unitrap ID UNI20178

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29478291..29479846 377
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037463 (Fbxo27) NM_207238 F-box protein 27 Gene [Source:MGI (curated);Acc:Fbxo27-001]

 
Come back to gene ENSMUSG00000037463


For any suggestions or comments, please send an email to unitrap@crg.es