Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AS0602
Clone ID AS0602
Vector pGT0lxr
Project sanger

Sequence tag AS0602
Sequence
GGTACTGCGGGCGCGCGGCAACCTTGGATCAACGCCCCGCTGCTCCGGCCGGCCCACTCTTTCCTTGCAAGCTGCGGCTT
CCTCGCGGAAACATTAAAGGGTCTGAAGAAGGGCGCGGGGCCGAGAGTCAGAGAGTGGGACCCGGGATCTCCCCGCGCCC
AGTGGGGCAACCATGACCGACGAGAGCTCCGATGTCCCCCGGGAGTTAATGGAAAGCATCAAGGATGTTATTGGCAGGAA
GATCAAAATCTCAGTGAAGAAGAAAGTGAAGTTGGAAGTGAAGGGCGACAGGGTGGAAAACAAAGTGCTGGTGCTCACAT
CATGCCGAGCCTTCCTCCTGTCAGCACGCATCCCCAGCAAGCTCGAGTTAACCTTCAGTTATCTAGAGATTCATGGAGTC
ATCTGCCACAAGCCAGCCCAG
Sequence Type mRNA
Unitrap ID UNI3853

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 24265485..24372641 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021338 (Lrrc16a) NM_026825 leucine rich repeat containing 16A Gene [Source:MGI (curated);Acc:Lrrc16a-001]

 
Come back to gene ENSMUSG00000021338


For any suggestions or comments, please send an email to unitrap@crg.es