Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST369969
Clone ID OST369969
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST369969
Sequence
GCAAGAGCAGGCGGAACCCATGGAGGCCTCTCTGGGTCCGCGCGGAGATCCCATGGTGGTGCTGTCAGTGGTCCCTGGGG
CAGCTGANGACCAACGGAGCCCCGAGGCCCACGATGGCACCTGCAGTGCGCAGGGAGAGGAGGACCCGANCTGTGGCCGA
GAGAACCTCTTCGGGCTGCAGGGGGCAGGCGGCTTCCAGGATCGGGAAGAGGAGTACTATGCTGAGCCTGGCGTGACTGA
GGCCGAGCCTGTAGCCACCGAGGATGCCAACAGCACTGACAGCCTCAAGTCCCCCAAGGTGAATTGTGAGGAGAGGAATG
NGACTGGGCTAGAAAACTTCACTCTGAAGATTTTAAATATGTCCCAGGACCTCATGGATTTCCTAAACCCAAATGGTAGT
GACTGTACACTGGTCCTCTTCTACACCCCG
Sequence Type mRNA
Unitrap ID UNI20184

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 55819263..55823002 358
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021497 (Txndc15) NM_175150 thioredoxin domain containing 15 Gene [Source:MGI Symbol;Acc:MGI:1916922]

 
Come back to gene ENSMUSG00000021497


For any suggestions or comments, please send an email to unitrap@crg.es