Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST369729
Clone ID OST369729
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST369729
Sequence
GTATCCCCTTGCTCAAACTGGCCGNCGCAAGCTGCAGAATCAAAGGGCTGCCTTGAACCNGCAGATCCTGAAGGCTGNGC
GGATGCTGGACAGGAGCCGAGAACCTTCTGAAGGTCGCCACAAACCAGAAGGTGCGGNAACAGGTTCGCCTGGAGCTGAG
CTTTGTCAACTCAGACCTGCAGATGCTGAAGGAGGAGCTGGAGGGGCTCAACATCTCCGTGGGAGTGTACCAGGGCACCG
AGGAAGCGTTCACCATTCCTCTGATTCCTCTCGGCCTGAAGGAGACCAAAGAAGTTGACTTTTCCA
Sequence Type mRNA
Unitrap ID UNI20200

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 36138758..36148700 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030494 (Rhpn2) NM_027897 rhophilin, Rho GTPase binding protein 2 Gene [Source:MGI (curated);Acc:Rhpn2-001]

 
Come back to gene ENSMUSG00000030494


For any suggestions or comments, please send an email to unitrap@crg.es