Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AS0508
Clone ID AS0508
Vector pGT0lxr
Project sanger

Sequence tag AS0508
Sequence
TTGTGAGCTTTTCGAGATGGTTTTTAAGAAGCCTCTACCTCCTACTGTGAAAAAGGAAGAGAGTCCTCCTCCACCTAAGG
TGGTAAATCCACTGATTGGTCTCCTGGGTGAATATGGAGGAGACAGTGACTATGAGGAAGAGGAAGAAGAGGAACAGGCT
CCTCCTGTGCAGCCTCAGCCTCAGCCTCGCGAGGAAATGACCAAGAAAGAGAATGAAGACGACAAACTCACTGACTGGAA
TAAACTGGCTTGTCTGCTCTGCAGAAGGCAGTTTCCCAATAAAGAAGTTCTTACGAAACACCAACAACTGTCCGACCTGC
ACAAG
Sequence Type mRNA
Unitrap ID UNI3952

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107684941..107686078 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032582 (Rbm6) NM_029169 RNA binding motif protein 6 Gene [Source:MGI Symbol;Acc:MGI:1338037]

 
Come back to gene ENSMUSG00000032582


For any suggestions or comments, please send an email to unitrap@crg.es