Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST369593
Clone ID OST369593
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST369593
Sequence
AACTGAGGACTTTATTGACCTAACATTATCCAAGNCTCAACGAAAGACTCCAACGGTTATTCATAAACATTATCAAATTC
ATCGGATTCGACATTTTTATATGAGAAAAGTCAAATTTACTCAACAGAATTACCATGACAGACTGTCACAGATTCTGTCG
GATTTCCCCAAATTGGATGATATCCATCCGTTTTATGCNTGACCTTGATGAATATTCTCTATGACAAGGATCACTACAAG
TTGGCTCTAGGTCAAATAAATATTGCCAAAAACTTGGTGGACAATGTTGCTAAAGATTANGAGCAANANTATGANGNATG
GTGANTCTCTGTACCGATGCAAGCAGCTGAAGCGCGCGGCCCTTGGACGAATGTGTACTATTATCAAGAGACAGAGGCAG
AGCTTGGAGTATCTGGAACAAGTACGTCAACATTTATCCCGCTTGCCAACCATTGATCCAAATACAAGGACTCTGCTTTT
GNGNGGGTATCCAAATGTTGGGAAATCCAGCTTCATCAACAAG
Sequence Type mRNA
Unitrap ID UNI3556

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8989944..8992063 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021149 (Gtpbp4) NM_027000 GTP binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1916487]

 
Come back to gene ENSMUSG00000021149


For any suggestions or comments, please send an email to unitrap@crg.es