Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST369571
Clone ID OST369571
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST369571
Sequence
GACTGAGGAATGTATCCTGTCGGGGNTAATGTCAGTGAATGGGAAGAAGGTTCTTCATATGGATCAGAACCCATACTATG
GAGGAGAAAGTGCGTCTATAACACCGCTGGAAGATGTAAGTCTCTGACGCACACGCTTACATGTTGGCTCATTTGGGACT
GTCCACTTTTGGACTCGCTCTTGGTTTTGGCTTCCTATTACTATATTTTTTTGTAGGGTAGGAGGAGGG
Sequence Type mRNA
Unitrap ID UNI20205

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3548107..3548330 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021218 (Gdi2) NM_008112 guanosine diphosphate (GDP) dissociation inhibitor 2 Gene [Source:MGI Symbol;Acc:MGI:99845]

 
Come back to gene ENSMUSG00000021218


For any suggestions or comments, please send an email to unitrap@crg.es