Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST369358
Clone ID OST369358
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST369358
Sequence
ACTGAGGTGTTGTCTTACATTAATGGAGTCATGACAAATAAACCTGGAACAGCCCTGGTCCACTNTATNTCTTCACGGAA
TGTGTCCCTGCGCCTGGGGGCACTCCAGGAGGGAGACTCTGGGACTTACCGCTGTTCTGTCAATGTGCAGAATGATGAAG
GCAAAAGTATAGGCCACAGCATCAAAAGCATAGAGCTCAAAGTGCTGGTTNCTCCAGCTNCTNCATCCTGTAGTTTACAG
GNNGTACCCTATGTCNGGACCAATGNGACCCTGAACTGCAAGTCCCCAAGGAGTAAACCTACATGCTCAGTACCAGTGGG
AGAGGCTGGCCCCATCCTCCCAGGTCTTCTTTGGACCAGCCTTAGATGCTGTTCGTGGATCTTTAAAGCTCACTAACCTC
TCCATTGCCATGTCTGGAGTCTATGTCTGCAAGGCTCAAAACAGAGTGGGCTTTGCCAAGTGCAACGTGACCTTGGACGT
GATGACAGGGTCCAAGGCTGCAGTGGG
Sequence Type mRNA
Unitrap ID UNI20220

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 37341736..37344608 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001946 (Esam) NM_027102 endothelial cell-specific adhesion molecule Gene [Source:MGI Symbol;Acc:MGI:1916774]

 
Come back to gene ENSMUSG00000001946


For any suggestions or comments, please send an email to unitrap@crg.es