Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST369235
Clone ID OST369235
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST369235
Sequence
GCGGGTCCCTGCTGCATGATCTTCCTGAGGACGTCAGAGAAAAACGGCTCTTGCTTCTTGCGCACGGATCAGCTGGATGG
AGAGACAGACTGGAAGCTTCGGCTCCCGGTGGCCTGCACACAGAGGCTTCCCACGGCTGCTGACCTCCTGCAGATTCGGT
CCTATGTGTACGCTGAAGAGCCCAACATCGACATTCACAACTTCCTGGGGACTTTCACCAGGGTGAGTGGCGCTGAATCC
AGCCTTGGGTGTGCGGCCCTGACGGTGCCCGAGGCTGCGAACTGCTGTGTCTATCTGAGGTTCCTTACCAAAGCCCAGCC
AGCCTTGAAGGCTGACAGTGGCTTTTCTGTGGGGACAGCACAGCTGGAATGTGTTGTGTCTGGCTCTGGCTCTGAGCTTG
AGTTCTAGAGCAGCAGGTGGNGTCTTCATCTGCTGTAGCTCTGAAGTCTGAACACAACCCCTGTCTTCTCCAGACGGGCA
GGNCCTCTTCTGGCTCGCAGAT
Sequence Type mRNA
Unitrap ID UNI13328

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168508933..168514845 357
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027546 (Atp9a) NM_015731 ATPase, class II, type 9A Gene [Source:MGI (curated);Acc:Atp9a-003]

 
Come back to gene ENSMUSG00000027546


For any suggestions or comments, please send an email to unitrap@crg.es