Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST369072
Clone ID OST369072
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST369072
Sequence
GACTGAGGGGAAACTGTTTGATTCTACAATTGCTGATGAAGGAACATGGACTTTGGAGGACAGAAANATGGTCCGNATTG
TCCTGACAAAAACCAAGAGAGATGCANNAAACTGNTGGACTTCTCTTTTAGAGTCTGAATATGCAGCGTGACCCCTGGGT
GCAAGACCAAATGCAGAGAANACTTACATTANAGCGATTCCAGAAAGAAAATCCTGGTTTTGACTTTAGTGGAGCANANA
TCTCAGGGAACTACACGAAGGGCGGACCAGATTTCTCAAACCTTGAGAAANGACTGCTATNGCTTAGNGTTTCTCTGTCT
NGTGGATCCCGGCAGGNGCTGGCANCTTAATGCAGTTGATGAGGAGAAGGATGGAGCAGCCAGNGTCTACAGTTAAAGAT
TGCCAAGTGTATTTCAATATGGTTGTAAAGATCACATTCAGATATGGTTTGCACAGGAGGCAGAGCAGCTCTAATGTGGA
TAGATGATAACTTTTACTGCTCTGCAGTAAGTG
Sequence Type mRNA
Unitrap ID UNI9838

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 40549518..40552963 285
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020328 (Nudcd2) NM_026023 NudC domain containing 2 Gene [Source:MGI (curated);Acc:Nudcd2-001]

 
Come back to gene ENSMUSG00000020328


For any suggestions or comments, please send an email to unitrap@crg.es