Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AS0067
Clone ID AS0067
Vector pGT0lxr
Project sanger

Sequence tag AS0067
Sequence
GTGGTTGTGAGCTTTTTGAGATGGTGGTTGTGAGCTCTTCTAGATTTTGGTTGTGAGCTCTTCTAGATGGTCTCCAAGCT
GCCTGACATGCTCAATGCGGAAATTGTTCTGGGCAATGTCCAGAATGCAAAGGATGCAGTGAACTGGCTGGGCTATGCCT
ACCTATACATCCGAATGCTCCGGTCCCCTACCCTCTATGGCATTTCTCATGATGACCTCAAGGGAGATCCCTTGCTGGAC
CAGCGCCGACTCGATCTTGTTCACACTGCTGCCTTGATGCTGGACAAGAACAATCTGGTCAAGTACGACAAGAAGACAGG
CAACTTCCAG
Sequence Type mRNA
Unitrap ID UNI3967

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 127052152..127052878 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003660 (Ascc3l1) NM_177214 activating signal cointegrator 1 complex subunit 3-like 1 Gene [Source:MGI (curated);Acc:Ascc3l1-001]

 
Come back to gene ENSMUSG00000003660


For any suggestions or comments, please send an email to unitrap@crg.es