Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AS0038
Clone ID AS0038
Vector pGT0lxr
Project sanger

Sequence tag AS0038
Sequence
GATGAAGATGTGTTGAAGAAGAACTGTCCTCATGTTGTGGTGGGGACACCAGGCCGGATCCTGGCACTTGTGCGGAGCAG
GAGCCTCAACCTGAGGAATGTGAAGCACTTTGTGCTAGATGAATGTGACAAGATGCTGGAACAGCTGGACATGCGCCGGG
ATGTACAGGAGATCTTTCGTCTGACACCCCATGAGAAGCTTGTTTATGATGTTCAGCGCCACCCTGAGCAAGGAGATCCG
GCCAGTCTGCAGGAAGTTCATGCAGGAT
Sequence Type mRNA
Unitrap ID UNI3972

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86244892..86245751 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005481 (Ddx39) NM_197982 DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 Gene [Source:MGI (curated);Acc:Ddx39-001]

 
Come back to gene ENSMUSG00000005481


For any suggestions or comments, please send an email to unitrap@crg.es