Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST368735
Clone ID OST368735
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST368735
Sequence
TTGTACAGTTTTCCTTTGTATTCACTTCCATTTTTACTTAATAACTGACTTGTTGGTGGCTCTTATTTCTGAATTCAAAG
CTTGTGAAAAAAAATAAA
Sequence Type mRNA
Unitrap ID UNI20257

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 37683255..37683352 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029121 (Crmp1) NM_007765 collapsin response mediator protein 1 Gene [Source:MGI Symbol;Acc:MGI:107793]

 
Come back to gene ENSMUSG00000029121


For any suggestions or comments, please send an email to unitrap@crg.es