Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AR1170
Clone ID AR1170
Vector pGT0lxr
Project sanger

Sequence tag AR1170
Sequence
GATGGTGGTTGTGAGCTCTTCNAGATGGTGGTTGTGAGCTCTTCTAGATGGTGGTTGTGAGCTCTTCTAGATGGTGGTTG
TGAGCTCTTCTAGATGGTGGTTGTGAGCTCTTCTAGATGGGACATGGACTGTATTCAGGCGCTACAGTCGTTTTCGAGAA
ATGCATAAAACATTGAAGCTAAAGTATGCAGAGCTCGCTGCTCTTGAATTCCCCCCAAAGAAGCTGTTGGAAACAAAGAC
GAGCGGGTAGTTGCTGAGCGGCGGACACACTTAGAG
Sequence Type mRNA
Unitrap ID UNI3945

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 142474164..142498110 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038844 (Kif16b) NM_001081133 kinesin family member 16B Gene [Source:MGI (curated);Acc:Kif16b-001]

 
Come back to gene ENSMUSG00000038844


For any suggestions or comments, please send an email to unitrap@crg.es