Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST368572
Clone ID OST368572
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST368572
Sequence
ACTGAGATTGCTGAAGCTAAAGAGATGTTTAACTCTAAATTTGGGTCCACACCCAAGTTTTATGTTCGAGCCCCAGGAAG
AGTCAACATAATAGGTGANCTCNGNCATANNNGTGGNNANANNTNTAATGCTCTNTGCCATGGAGAGAACAAAGAGCATG
TTTACTACAC
Sequence Type mRNA
Unitrap ID UNI20265

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 125704012..125704104 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027207 (Galk2) NM_175154 galactokinase 2 Gene [Source:MGI (curated);Acc:Galk2-001]

 
Come back to gene ENSMUSG00000027207


For any suggestions or comments, please send an email to unitrap@crg.es