Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST368554
Clone ID OST368554
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST368554
Sequence
ACTGAGGCAAATCGGGAGCGGTGCCGAGNAAAATTTCCTTTCTTCAATAAATGACTTCTTTTGTTTGATGGTTGCGTTCT
TGATCTTGTTTGCCATGTAACAGAAATTACTGCCTGAAATGTTGGCATTCATAGTAATTACGGATGTAATTCTGTGTATC
TTGCTGTGACTCCGAAGACTGTAGTACCTGGTGTCATGGAAATATATGTTATTTCCACAGTCATTTCATTAAAGATGAAA
ACTTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI11988

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 73746504..73746693 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018770 (Atp5g3) NM_175015 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 3 Gene [Source:MGI (curated);Acc:Atp5g3-002]

 
Come back to gene ENSMUSG00000018770


For any suggestions or comments, please send an email to unitrap@crg.es