Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC1099
Clone ID GC1099
Cell line E14Tg2A.4
Vector pFlip1
Project tigem
Note NULL

Sequence tag GC1099
Sequence
CCGAACTCCACCTTCACACATAAGGGCGCCGCCCTGTTTAGGAAACCAAACTCCCCCCCCCCCCCCCCGGTTTTTTGGGG
GGGGGTGAAGGGTTCTTCTTCTTTGGTTTTCGGGACCTGGGACCCGAACTCCACCTTCACACATAAGCGCGCCGCATTGT
TTAAGAAACG
Sequence Type mRNA
Unitrap ID UNI370

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29682904..29682955 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069020 (Urm1) NM_026615 ubiquitin related modifier 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Urm1-001]

 
Come back to gene ENSMUSG00000069020


For any suggestions or comments, please send an email to unitrap@crg.es