Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AR0933
Clone ID AR0933
Vector pGT0lxr
Project sanger

Sequence tag AR0933
Sequence
TAAAAGGGTTTTTTTTTTTTAATGGGATTGGTTACGTTGGTGTAGATGGGCGCATCGTAACCGTGCATCTGACAGGTTCG
AGGAGTCCGCCAAGGCCTACCACGAGCTTCTGGAGGCTCGCCTGCTGCGGGAGGCAGTGTCATCCGGAGATGAGAAGGAA
GGGCTGAAACACCCTGGACTGATACTGAAATATTCTACATATAAGAACCTGGCCCAGCTGGCGGCCCAGCGAGAGGACCT
GGAGACCGCCATGGAATTTTATTTGGAG
Sequence Type mRNA
Unitrap ID UNI3981

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75216122..75217059 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020196 (Cabin1) NM_172549 calcineurin binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1298375]

 
Come back to gene ENSMUSG00000020196


For any suggestions or comments, please send an email to unitrap@crg.es