Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST368149
Clone ID OST368149
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST368149
Sequence
GAGAACATGAATAGCTCTTTTCTGAGGCCCGAGGACAACAGGATGTTCTTTCCTCACCTTTGGAACGGGTGCCCCCAGCA
TCCCGGCCCGGGAAGGCTCCACTTGGCACTCCTAAAACCCCAGTCCTCGAAGACTTTCCTCAGAATGACGATGAAAAGGA
GCGGATGCAGCGGAGACGCCTCCAGGGTCTTTGACCTGCAGTTCAGTACAGATTCGATTCATCTGGCCTCCCCTAACAGG
AATATTGATGTTTCAACTACCATATCTAAGTTTACAAACACACAGATTACAGAACATTACTCTACCTGTATCAAGCTTTC
TTCTGAAAATAAAATCACTACTAAGAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI18801

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 126952840..126953453 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034906 (Ncaph) NM_144818 non-SMC condensin I complex, subunit H Gene [Source:MGI (curated);Acc:Ncaph-001]

 
Come back to gene ENSMUSG00000034906


For any suggestions or comments, please send an email to unitrap@crg.es