Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AR0467
Clone ID AR0467
Vector pGT0lxr
Project sanger

Sequence tag AR0467
Sequence
GTGGTTGTGAGCTTTTTTAGATGGTGGTTGTGAGCTCTTCTAGATGGTGGTTGTGAGCTTTTCTAGATGGTTTTTTTTGC
ACATGAGTGTTCAAGCGACTCAGAACAGTCAGGTTCCAGCTGAGCGTCCCAGAACTGTTTCCCGCACCAGTGACAGTGAC
CCGGTGAAGCAGAGGGTAGTCAGACATGAGGTGTCAGTCAAGACAGCTATCTCCCATACCAGGTATCATGAAGATCAAGA
GTTGGACTCAGCGAACTGTCGGTCTTCGTGTACATGACTGCAGGTCCNCA
Sequence Type mRNA
Unitrap ID UNI2291

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88740069..88740165 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068921 (Dap3) NM_022994 death associated protein 3 Gene [Source:MGI (curated);Acc:Dap3-001]

 
Come back to gene ENSMUSG00000068921


For any suggestions or comments, please send an email to unitrap@crg.es