Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AR0430
Clone ID AR0430
Vector pGT0lxr
Project sanger

Sequence tag AR0430
Sequence
TTTTTTTTGACTGCTGCAAGGCATGGCCCATTTCTCCAGCGAGGATGAGGTGATGCTGCAGGCGATGCTCCGGCAGCTGT
TCCAGAGCGTGAAGGAGAAAATCACCGGAGCTCCCTCCTTGGAGTGCGCAGAGGAGATCCTCTTGCGGCTGGAGGAGACT
GACGAAAATTTTCACAACTATGAATTTGTGAAATACCTCAGACAGCACATATGTAACATGTTGGGGTCTATGATTGAAGA
AGAAATGGAAAAATGCACATCTGATCAGAATCAGGGGGAGGATTCTGGCTATGACACGGTTGTTCAGCATGTTACCAAAA
GAACGCAGGAATCTAAAGAGTATAAGGAAATGATGCATTCCCTGAAGAACATTATGATGGTGGTGGTCGAGGCGATGATC
AACAAGTTTGAGGAAGACGAGACACGGAGTGAGGACAGGCAGAGGAAAATGCAGAGTGGCAGCTGCTGCACAGACAACTG
CTCCGACAGTGACTCCTCCTTCAATCAG
Sequence Type mRNA
Unitrap ID UNI3991

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 55934756..55948455 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078446 (AC153521.7)  

 
Come back to gene ENSMUSG00000078446


For any suggestions or comments, please send an email to unitrap@crg.es