Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AR0336
Clone ID AR0336
Vector pGT0lxr
Project sanger

Sequence tag AR0336
Sequence
GAATATGGCGGCGCCCAGTGGCAGTGTGAACTGTGAAGAGTTCGCCGAGTTCCAGGAATTACTCAAGGTGATGAGGACAA
TTGATGACAGAATAGTACATGAATTAAACACTACGGTTCCAACAGCTTCCTTTGCAGGGAAAATCGATGCCAGCCAAACC
TGTAAACAGCTGTATGAGTCTTTGATGGCAACTCATGTCAGTAGGGACAGAGTTATAAAGAACTGTATAGCCCAGACCTC
AGCAGTAGTAAAAAGTCTCCGAGAAGAGAGAGAAAAGAACCTGGATGACTTAACGTTATTAAAGCGACTTAGAAAAGAAC
AGACAAAGTTGAAATGGATGCAGTCAGAACTAAATGTCGAAGAAGTGGTAAATGACAGGAGCTGGAAG
Sequence Type mRNA
Unitrap ID UNI3994

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 36072170..36090046 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075229 (Ccdc58) NM_198645 coiled-coil domain containing 58 Gene [Source:MGI Symbol;Acc:MGI:2146423]

 
Come back to gene ENSMUSG00000075229


For any suggestions or comments, please send an email to unitrap@crg.es