Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST367606
Clone ID OST367606
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST367606
Sequence
ACTGAGCACATGGCCAATGCCTTGGCCAGTGCCACGTGTGAGCGCTGCANGGGAGGCTTTGCTGCCTGCTGAGAAGATCG
TGAACAGTAATGGTGAGCTGTACCACGAACAGTGCTTCGTATGTGCTCAGTGCTTCCAGCAGTTCCCAGAAGGACTCTTT
TATGAGTTTGAAGGAAGGAAGTACATGTGAGCATGATTTCCAAANGCTCTTTGCTCCCTGCTGCCACCANTGNGGCGAAT
NCATNATTGACNGNTNTATNAAAGCCATGAACAACAGCTGGCATCCTGAGTGCT
Sequence Type mRNA
Unitrap ID UNI19849

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 57861771..57872367 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019920 (Lims1) NM_026148 LIM and senescent cell antigen-like domains 1 Gene [Source:MGI (curated);Acc:Lims1-001]

 
Come back to gene ENSMUSG00000019920


For any suggestions or comments, please send an email to unitrap@crg.es