Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST367597
Clone ID OST367597
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST367597
Sequence
ATGTTAAGGTGCATGGCGGCCTGCTGCAGATCTTCCCCGAGGGTCGGCCAGTGGTAGCCAACATCGAGCCACCTCTTTGA
CCGGTTGCTCATTTTCTGGTCTGACCGACGGAACCCACATGAGGTGAAGCCAGCCTATGCCACCAGGTACGCCATCACTG
TCTGGTATTTTGATGCCAAGGAACGGGCAGCAGCCAGAGACAAGTATCAGCTAGCATCGGGACAGAAAGGTGTTCAAGTA
CCAGTATCACAGCCAACTACACCTACCTAATGGCCAGCCCCAGAGCTGCGTGGACCAGCAGCAGCTCCTGCCTCAGTGCC
CGCTCCTTTCCTGCCACTGCTGCTGCTTCTGGCTTGCCTCTGTACTGTGTGGTGTGGAGGGCACTAAGTATCACTGAGGA
GCAACAAGGAGAGACCTCTGCTGCCCCGTGAGCGAGCGGTGCTG
Sequence Type mRNA
Unitrap ID UNI20311

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 27944001..27944944 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058709 (Egln2) NM_053208 EGL nine homolog 2 (C. elegans) Gene [Source:MGI (curated);Acc:Egln2-001]

 
Come back to gene ENSMUSG00000058709


For any suggestions or comments, please send an email to unitrap@crg.es