Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AR0181
Clone ID AR0181
Vector pGT0lxr
Project sanger

Sequence tag AR0181
Sequence
GCAGGGTTGGAGGTCAGAGGACAGCTTGGTGGAGTGAGTTCTTTCCTTCCACCTCCATGAGTTCTGGAGATCAAACTCAG
GTCACCAGGACTGCAGGGCAAGCGCTTTTACCTACTGAGCTACATGCTGGCTCCTGGTAGGTGCTCCTCAGTGTCAGAGG
TTATGTCCTTTCCAGCTTCTGCTTTGGTGAGATTATACTTGTGAATTTGCAAACGAGGTGTCTAATATTGCTGTGTAATA
GTGACAAGCTAAGTCAGTCGCATTCCATATAACCTCTAGCTTGTCTCTGTGTCTGCTTCCAGACTTTCTCCCTGTGCTTG
GGATATGCTGCTGTAAAATTGGAATCCCCATGTTGTTATTGCTAACTTCTTTTGCCTTTTTGAATTAATAGTCAAAGAAT
CTGAGCCTGGAAGATATGAGCACAAGTGATGATAACTGTGTGGCTGGATTGATAGACTATGAATTGTGTGAAGATAAATT
ATTAGCTCCAAAGACGCCACAG
Sequence Type mRNA
Unitrap ID UNI3997

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 44357393..44357895 497
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035683 (Melk) NM_010790 maternal embryonic leucine zipper kinase Gene [Source:MGI (curated);Acc:Melk-001]

 
Come back to gene ENSMUSG00000035683


For any suggestions or comments, please send an email to unitrap@crg.es