Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AR0160
Clone ID AR0160
Vector pGT0lxr
Project sanger

Sequence tag AR0160
Sequence
TTGTGAGCTCTTCTAGATGGTGGTTGTGAGNCTTTCTAGATGGTGTGGAGCAAAGAAATCTGCCTNGGAAATTTGAGCAT
ATAGGAATCGGGCTTCTGTCTCTACTCCTAAGGGATGACAGAGTGTTGCCTCTTCGTGCCATACGTTTTTTTGTTGAAAA
TCTCAACCATGATGCAAGTGTGGTTTGAAAGATGGCTATCTCAGCTGTTGCTGGTATTCTCAAGCAGCTAAAGAGAACTC
ACAAAAAGCTGACTATCAACCCTTATGAAATCAGTGGATGTCCTAAACCTACCAAAATTCTTGCTGGTGATAGACCTGAT
AACCATTGGTTGCATTATGATAGTAAAAATATACCAAGAACAAAAAAAGAATGGGAGTCAAGTTGCTTTGTTGAAAAAAC
TCACTGGGGATACTACAACTGGCCAAAGAATATGGTTGTTTATGCTGGTGTGGAAGAACAGCCTAAACTTGGCAGAAGCA
GGGAGGATATGATAGAG
Sequence Type mRNA
Unitrap ID UNI3999

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 30741594..30745897 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040850 (Psme4) NM_134013 proteasome (prosome, macropain) activator subunit 4 Gene [Source:MGI (curated);Acc:Psme4-001]

 
Come back to gene ENSMUSG00000040850


For any suggestions or comments, please send an email to unitrap@crg.es