Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AR0147
Clone ID AR0147
Vector pGT0lxr
Project sanger

Sequence tag AR0147
Sequence
GTTGTGAGCTATTCTAGATGGTGGTTGTGAGCTCTTCTAGATGGTAGGCCTGCCTGCTGCTGGCAAGACCACGTGGGCCA
TCAAACACGCTGCCTCCAACCCTTCCAAGAAGTACAACATTCTGGGTACCAATGCCATCATGGATAAGATGCGGGTGATG
GGCCTGCGGAGGCAGCGGAACTATGCTGGTCGCTGGGATGTCCTGATCCAGCAGGCCACTCAGTGCCTCAACCGTCTTAT
TCAGATCGCTGCCCGAAAGAAGCGAAACTATATCCTAGATCAG
Sequence Type mRNA
Unitrap ID UNI1901

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26518035..26518377 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040725 (Hnrnpul1) NM_178089 heterogeneous nuclear ribonucleoprotein U-like 1 Gene [Source:MGI Symbol;Acc:MGI:2443517]

 
Come back to gene ENSMUSG00000040725


For any suggestions or comments, please send an email to unitrap@crg.es