Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST367018
Clone ID OST367018
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST367018
Sequence
GGGTTTACATCTCCGACCTTCAAACCTGCAACGTNTCCTCTGACATCACTCAGACAGTATCCTCCTAGAAGCAGGAAAAA
TTCCTTTGGCTATCGGAAGAAAAGAGAAGAGAAGTTTACAAGCAGTCAGACGCAGTCTCCAACACCACCAAAGCCTCCAT
CACCGAGCTTCGAACTGGGACTGGCCAACTTCCCCCCATTACCTGGAGCTGCAGGCAA
Sequence Type mRNA
Unitrap ID UNI19810

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9157402..9165660 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033499 (Larp5) NM_172585 La ribonucleoprotein domain family, member 5 Gene [Source:MGI Symbol;Acc:MGI:106330]

 
Come back to gene ENSMUSG00000033499


For any suggestions or comments, please send an email to unitrap@crg.es