Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST366810
Clone ID OST366810
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST366810
Sequence
GAAGAGCTGGAAGAAGGACAGAAAGGAGTAGGCTGTTGGCACAGTTAGCTGGGGTCTGGAGGACGACGAGGACATGACAC
TTACAAGATGGACAGGCATGATAATTGGACCTCCACGAGTAAGCACCAAGCTCCAGCTGTCACTGTCATCGAGTTAAGCT
CACTGTGCCTTTCCTTAAAGCAGTTGGCAGACACTCA
Sequence Type mRNA
Unitrap ID UNI2027

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 167443250..167443445 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078923 (Ube2v1) NM_023230 ubiquitin-conjugating enzyme E2 variant 1 Gene [Source:MGI (curated);Acc:Ube2v1-003]

 
Come back to gene ENSMUSG00000078923


For any suggestions or comments, please send an email to unitrap@crg.es