Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST366729
Clone ID OST366729
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST366729
Sequence
CAATTCCCAGTCAGAGGCGCTATGTATATTATTATAGCTACCTGCTAAAAAATCACCTGGATTACAGACCCGTGGCACTG
CTGTTTCACAAGATGATGTTTGAAACTATTCCAATGTTCAGTGGCGGAACTTGCAATCCTCAGTTTGTGGTCTGCCAGCT
AAAGGTGAAGATATATTCCTCCAATTCAGGACCCACGCNGGCGGGAGGACAAGTTCATGTACTTTGAGTTCCCTCAGCCA
TTGCCTGTGTGTGGTGATATCAAAGTAGAGTTCTTCCACAAACAGAACAAGATGCTCAAAAAGGACAAAATGTTTCACTT
TTGGGTAAATACGTTCTTCATACCAGGACCAGAGGAAACCTCAGAAAAAGTGGAAAATGGAAGTCTTTGTGATCAGGAAA
TCGATAGCATTTGCAGTATAGAGCGTGCAGATAATGACAAGGAGTATCTTGTACTCACCCCTAACAAAAAACGATCTTGA
CAAAGCAAACAAAGACAAGGCCAACCGATACTTCTCTCCAATTTTAAGGGGAACTATACTTTACAAAACAGTA
Sequence Type mRNA
Unitrap ID UNI20342

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32886193..32894359 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013663 (Pten) NM_008960 phosphatase and tensin homolog Gene [Source:MGI (curated);Acc:Pten-001]

 
Come back to gene ENSMUSG00000013663


For any suggestions or comments, please send an email to unitrap@crg.es