Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AR0038
Clone ID AR0038
Vector pGT0lxr
Project sanger

Sequence tag AR0038
Sequence
GATGGTTNTTAGCAAATGAAAGCAAGATTCTTCCTATGGGCTTGGACTGCTTATCACAAGTCACAACATTTCTTAAAGGA
GTAACTATTCCCAATTCTGGGGCAGACACTTTAGGTCGTCGATTAGCTTCTGAGTTGCTGCTTGGCTTAGCAGCTCAGAG
AGGCTCTTTGAGATACCTTCTTGAATGGATAGAAATGGCTTTGGGGGCTTCAGCAGTTGTATATACTATGGAGAAAAACA
AACTACTGTCAAGCCAGGAAGGAATGATCAGCTTTGACTGCTTTATGGCTATATTAATGCAGATGAGGCGATCTTTGGGT
TCATCTGCTGATCGGAGTCAGTGGAGAGAACCAACTAGAACATCTGAAGGCTTATTTCTGCTCTAGGGCTCTGCAAGATG
TTTTTTTGAAGAGGTC
Sequence Type mRNA
Unitrap ID UNI4010

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 66220233..66224221 309
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038664 (Herc1) hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1 Gene [Source:MGI (curated);Acc:Herc1-001]

 
Come back to gene ENSMUSG00000038664


For any suggestions or comments, please send an email to unitrap@crg.es