Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST366278
Clone ID OST366278
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST366278
Sequence
ACTGAGGATCGCATGGTCCGCTACTGCCTTTACCAAGTCGTTATAGAATGGGCTCTAGAGATACACCTGAACTTGTTGCT
TATCCATTACCACAAGCGTCTTCCTCTTACATGCATGGAGGCAGTCCGTCTGGCTCCGTTGTAATGGTTAGTGGATTACA
TCAGCTCAAAATGAATTGTTCAAGAGTCTTCAACCTGTTCTGCTTGTATGGAAATATTGAAAAGGTAAAGTTTATGAAGA
CCATTCCTGGCACAGCACTCGTAGAAATGGGTGACGAGTACGCCTGTGGAAAGAGCTGTCACCCACCTTAATAATGTCAA
ACTCTTTGGGAAAAGACTTAATGTTTGTGTGTCTAAACAGCACTCAGTTGTTCCCAGTCAAATATTTGAGCTAGAGGATG
GTACGAGCAGCTACAAAGATTTTGCAATGAGCAAAAATAATCGCTTTACAAGTGCTGGACAAGCATCTAAGAATATAATC
CAGCCACCGTCATGTGTGCTGCATTATTACAATGTTCCGCTGTGTGTCACAGATTAC
Sequence Type mRNA
Unitrap ID UNI9773

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 80433402..80438151 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024095 (AC122253.5) NP_659051 Heterogeneous nuclear ribonucleoprotein L-like [Source:UniProtKB/Swiss-Prot;Acc:Q921F4]

 
Come back to gene ENSMUSG00000024095


For any suggestions or comments, please send an email to unitrap@crg.es